Select the search type
 
  • Site
  • Web
Search

 

Minimize

 

Pinctada albina
(Lamarck, 1819)

Shark Bay Shell

Nicholai Cushing (2014)

 

 

Fact Sheet

Minimize

Summary


Physical Description


Ecology


Life History & Behaviour


Anatomy & Physiology


Evolution & Systematics


Biogeographic Distribution


Conservation & Threats


References & Links

Evolution & Systematics


Phylogeny

P. albina  is a multicellular eukaryotic organism and therefore belongs to the kingdom Animalia (Ruppert et al., 2004). They have a mantle and mantle cavity used in secretion and respiration, a characteristic shared by Molluscs (Ruppert et al., 2004). They have two calcareous valves (shells) very similar in size and lack a radula (specialised feeding structure of molluscs), defining characteristics of the class Bivalvia (Ruppert et al., 2004). The order Pterioida contains many families of marine bivalve including the family Pteriidae, the winged and pearl oysters defined by their shell shape (Southgate & Lucas, 2008). Genus Pinctada has fossil records dating back to the Miocene epoch approximatley 23 million years ago (Ruppert et al., 2004, Southgate & Lucas, 2008). The species, Pinctada albina, was initiailly documented by Lamarck (1819) and discovered in Shark's Bay, Western Australia (Pearl Guide, 2011). Since the discovery the species has been sub-divided into two subspecies, Pinctada albina albina (Lamrack, 1819) and Pinctada albina sugillata (Reeve, 1857), to reflect east and west populations (O'Connor, 2002, Pearl Guide, 2011). For the purposes of this study, based on the genetic analysis and lack of literature on the species, the specimens have not been classed to sub-species.


Kingdom---Animalia  

Phylum---------Mollusca 

Class----------------Bivalvia (Linneaus, 1758)

Subclass------------Pteriomorphia (Beurlen, 1944)

Order-------------------Pterioida (Newell, 1965)

Suborder---------------Pteriina (Newell, 1965)

Superfamily------------------Pterioidea (Gray, 1847)

Family-------------------------Pteriidae (Gray, 1847)

Genus-------------------------------Pinctada (Röding, 1798)

Species-----------------------------------Pinctada albina (Lamarck, 1819)

Taxonomic framework for Pinctada albina (Constructed with information from Rupper et al., 2004, Southgate & Lucas, 2008, Temkin, 2010, WoRMS, 2014)


Genetic sequence

The genetic sequence for the specimens found in Moreton Bay is provided below along with comparisons of another two P. albina sequences. To obtain this information a swab was taken from the mantle cavity of one of the specimens. The DNA was then extracted and the DNA samples amplified using a polymerase chain reaction (PCR) using the forward primer (CCTGCGGAAGGATCATTAAC) and the reverse primer (GCTAGGTTTAAAGAGCGGCC). These primers amplify a region of ribosomal DNA frequently used in phylogenetic analysis. The product of the PCR was then sequenced and the alignment performed using default settings in CLUSTALX (Thompson et al., 1997). Special thanks to Dr. Carmel McDougall for performing the analysis of the specimen. The studied specimen is listed in the sequencing (below) as 'Moreton bay pearl oyster'.


'Moreton bay pearl oyster' CCTGCGGAAGGATCATTAACAAAAAG----------------------------------
'P. albina 1'                     CCTGCGGAAGGATCATTAACAAAAAG----------------------------------
'P. albina 2'                     CCTGCGGAAGGATCATTAACAAAAAG----------------------------------

'Moreton bay pearl oyster' -------------GCAAGAGACCTCGTCTCTTCGCTGA-ACAATCACTCAAAGCATTGCG
'P. albina 1'                     -------------GCAAGAGACCTCGTCTCTTCGCTGA-ACAATCACTCAAAGCATTGCG
'P. albina 2'                     -------------GCAAGAGACCTCGTCTCTTCGCTGA-ACAATCACTCAAAGCATTGCG

'Moreton bay pearl oyster' AACTTTT------TCGGGAGAGAAGGACGTAAAGTCCGAGGCACTCC-----------CC
'P. albina 1'                     AACTTTT------TCGGGAGAGAAGGACGTAAAGTCCGAGGCACTCC-----------CC
'P. albina 2'                     AACTTTT------TCGGGAGAGAAGGACGTAAAGTCCGAGGCACTCC-----------CC

'Moreton bay pearl oyster' ---CAAACAAAATACGATGTGCTCGTTCGGGGTACCCAAATCTG-GTGGGTTTAAAGTGT
'P. albina 1'                     ---CAAACAAAATACGATGTGCTCGTTCGGGGTACCCAAATCTG-GTGGGTTTAAAGTGT
'P. albina 2'                     ---CAAACAAAATACGATGTGCTCGTTCGGGGTACCCAAATCTG-GTGGGTTTAAAGTGT

'Moreton bay pearl oyster' TCGCTTTTCTGTGTTGCAACCGCCCCTTTTCAACA---GGCGCCAGTAGTGGGTACTTGG
'P. albina 1'                     TCGCTTTTCTGTGTTGCAACCGCCCCTTTTCAACA---GGCGCCAGTAGTGGGTACTTGG
'P. albina 2'                     TCGCTTTTCTGTGTTGCAACCGCCCCTTTTCAACA---GGCGCCAGTAGTGGGTACTTGG

'Moreton bay pearl oyster' GCCGAGCTTTTT--CTGAGTTGGCTCGGCGAGAGTCCGCTTCCTCATTC--GAAGTGGCT
'P. albina 1'                     GCCGAGCTTTTT--CTGAGTTGGCTCGGCGAGAGTCCGCTTCCTCATTC--GAAGTGGTT
'P. albina 2'                     GCCGAGCTTTTT--CTGAGTTGGCTCGGCGAGAGTCCGCTTCCTCATTC—GAAGTGGTT

'Moreton bay pearl oyster' AGGTTTAAAGAGCGGCC
'P. albina 1'                     AGGTTTAAAGAGCGGCC
'P. albina 2'                     AGGTTTAAAGAGCGGCC







Classification

Minimize
Kingdom
Animalia
Phylum
Mollusca
Class
Bivalvia
Order
Ostreida
Superfamily
Pterioidea
Family
Pteriidae
Genus
Pinctada

Synonyms

Avicula anomioides (Reeve, 1857)
Avicula atropurpurea (Dunker, 1852)
Avicula concinna (Dunker, 1872)
Avicula fimbriata (Reeve, 1857)
Avicula flexuosa (Reeve, 1957)
Avicula imbricata (Reeve, 1857 [non Pinctada imbricata Röding, 1798])
Avicula irradians (Reeve, 1857)
Avicula placunoides (Reeve, 1857)
Avicula radula (Reeve, 1857)
Avicula reentsii (Dunker, 1872)
Avicula reeveana (Dunker, 1872)
Avicula scheepmakeri (Dunker, 1872)
Avicula sugillata (Reeve, 1857)
Avicula tristis (Dunker, 1872)
Meleagrina albina (Lamarck, 1819)
Pinctada atropurpurea ((Dunker, 1852))
Pinctada perrutila (Iredale, 1939)
Pteria carchariarum (Jameson, 1901)
Pteria placunoides ()

Common Names

モスソアコヤ